rcAAV-5/N Quantitation Kit

Name: rcAAV-5/N Quantitation Kit
Brand: SHENTEKBIO
Availability: InStock

Product Number: 1403445

SHENTEK^® rcAAV Quantitation Kit is suitable for qPCR detection of replication-competent adeno-associated virus (rcAAV) from cell culture harvested bulk and purified stock. This rcAAV-5/N Quantitation Kit is designed for the quantification of rcAAV-5/N contamination in serotypes of rAAV-5/N (N stands for possible different capsid serotypes). The sample types include but are not limited to recombinant adeno-associated virus (rAAV) bulk and end-products, as well as harvested samples from cell culture desired for rcAAV detection.

Key information before using this kit:

1. AAV serotypes

2. The inverted terminal repeat (ITR) sequence of the test sample rAAV need to match the following sequences:

ITR sequence of rAAV-5/N

CTCTCCCCCCTGTCGCGTTCGCTCGCTCGCTGGCTCGTTTGGGGGGGTGG

CAGCTCAAAGAGCTGCCAGACGACGGCCCTCTGGCCGTCGCCCCCCCAA

ACGAGCCAGCGAGCGAGCGAACGCGACAGGGGGGAGAGTGCCACACTC

TCAAGCAAGGGGGT

Get Connected

Add to cart

Overview -SHENTEK^® rcAAV-5/N Quantitation Kit

Components	Shipping Condition	Unit Size	Detection Method
T & R DNA Control - 5	-20℃	100 reactions × 2	Probe-based qPCR
rcAAV qPCR Reaction Buffer	-20℃, protect from light
Target Primer&Probe MIX-5
Reference Primer&Probe MIX-5
100×ROX
DNA Dilution Buffer (DDB)
ddH₂O	-20℃

Specification - SHENTEK^® rcAAV-5/N Quantitation Kit

Range	Target-5: 2 - 2×10⁶ copies/μL, R²= 0.999，E=95.3%
Range	Reference-5: 2 - 2×10⁶ copies/μL, R²= 0.999，E=94.8%
Accuracy	Target-5: Recovery = 105.2%-123.7%, CV<30%
Accuracy	Reference-5: Recovery = 93.5%-121.5%, CV<30%
LOQ	Target-5: 2 copies/μL
LOQ	Reference-5: 2 copies/μL
LOD	Target-5: 4×10^-1 copies/μL
Precision	Target-5: 7.1%-8.2% (≤20%)
Precision	Reference-5: 6.5%-9.8% (≤20%)
Robustness	Freeze-thaw stability over 5 cycles
Robustness	Instrument suitability not limited to Thermo, Biorad, Roche, SHENTEK qPCR equipments