Medical Consumables and Lab Consumables OEM Manufacturer
Medical Consumables and Lab Consumables OEM Manufacturer

rcAAV-5/N Quantitation Kit

For Research Use Only (RUO)
Product Number: 1403445

SHENTEK® rcAAV Quantitation Kit is suitable for qPCR detection of replication-competent adeno-associated virus (rcAAV) from cell culture harvested bulk and purified stock. This rcAAV-5/N Quantitation Kit is designed for the quantification of rcAAV-5/N contamination in serotypes of rAAV-5/N (N stands for possible different capsid serotypes). The sample types include but are not limited to recombinant adeno-associated virus (rAAV) bulk and end-products, as well as harvested samples from cell culture desired for rcAAV detection.


Key information before using this kit:

1. AAV serotypes

2. The inverted terminal repeat (ITR) sequence of the test sample rAAV need to match the following sequences:

ITR sequence of rAAV-5/N

CTCTCCCCCCTGTCGCGTTCGCTCGCTCGCTGGCTCGTTTGGGGGGGTGG

CAGCTCAAAGAGCTGCCAGACGACGGCCCTCTGGCCGTCGCCCCCCCAA

ACGAGCCAGCGAGCGAGCGAACGCGACAGGGGGGAGAGTGCCACACTC

TCAAGCAAGGGGGT

Contact
Get Connected
Add to cart
Add to cart
rcaav testing

Overview -SHENTEK® rcAAV-5/N Quantitation Kit

ComponentsShipping ConditionUnit SizeDetection Method
T & R DNA Control - 5-20℃100 reactions × 2Probe-based qPCR
rcAAV qPCR Reaction Buffer-20℃, protect from light
Target Primer&Probe MIX-5
Reference Primer&Probe MIX-5
100×ROX
DNA Dilution Buffer (DDB)
ddH2O-20℃






Specification - SHENTEK® rcAAV-5/N Quantitation Kit

RangeTarget-5: 2 - 2×106 copies/μL, R2= 0.999,E=95.3%
Reference-5: 2 - 2×106 copies/μL, R2= 0.999,E=94.8%
AccuracyTarget-5: Recovery = 105.2%-123.7%, CV<30%
Reference-5: Recovery = 93.5%-121.5%, CV<30%
LOQTarget-5: 2 copies/μL
Reference-5: 2 copies/μL
LODTarget-5: 4×10-1 copies/μL
PrecisionTarget-5: 7.1%-8.2% (≤20%)
Reference-5: 6.5%-9.8% (≤20%)
RobustnessFreeze-thaw stability over 5 cycles
Instrument suitability not limited to Thermo, Biorad, Roche, SHENTEK qPCR equipments






Related Products

SHENTEK® Virus DNA & RNA Extraction Kit

SHENTEK® rcAAV-2/N Quantitation Kit


Products

Documents & Download

Assay Validation Summary (on Request)
Certificate of Analysis
Connect with SHENTEK
Reliable and Trusted Partner For Biologics Quality Control Kits and Instruments
For Inquiries

Email: info@shentekbio.com

Telephone: 

US Mobile: +1-908-822-3199

US Office: +1-800-960-3004 ext 720

China Office: +86-400-878-2189

Address: 

USA site: 3350 Scott Blvd Bldg 6, Santa Clara, CA 95054

China site: No.1366 Hongfeng Road, Huzhou, Zhejiang, China, 313000



Request a Quote
Add to cart Add to cart
Add to cart
Contact Us Now!
Certificate of Analysis
+
Product Number
Lot Number
Close
Add to Cart (0)
Empty
Inquire
We use cookies to offer you a better browsing experience, analyze site traffic and personalize content. By using this site, you agree to our use of cookies. Visit our cookie policy to learn more.
Reject Accept